chr11_3 | ||
cmsearch-Rfam |
||
Family :5S_rRNA |
Id:RF00001 |
Type:Gene; rRNA; |
Taxonomy:Eukaryota; Bacteria; Viruses; Archaea; | Ontology:GO:0003735 structural constituent of ribosomeRF00001 |
|
Description:5S ribosomal RNA (5S rRNA) is a component of the large ribosomal subunit in both prokaryotesand eukaryotes. In eukaryotes, it is synthesised by RNA polymerase III (the other eukaryotic rRNAs are cleaved from a 45S precursor synthesised by RNA polymerase I). In Xenopus oocytes, it has been shown that fingers 4-7 of the nine-zinc finger transcription factor TFIIIA can bind to the central region of 5S RNA. Thus, in addition to positively regulating 5S rRNA transcription, TFIIIA also stabilises 5S rRNA until it is required for transcription. | ||
Score:99.4 |
E-value:6.7e-21 |
|
From sequence:68610 |
To sequence:68492 |
|
Alignments: v NC | ||
RNAfold |
||
>chr11_3 GAGUACGGCACUCAGGGUUCCCGAGUCAUCACUGACCUCAGUACUAACUG AGCCUGUGAGUGCUUAACUUCACAAAUCGGACGGGAUAUGGUGUUUUCAC UCAAGUAUGGUCGUACUC (((((((((.........(((((.((((....))))((((((....))))))(((((((((.....)).)))))....)).)))))...((((....))))........))))))))) (-37.00) |
||
Length sequence: 118 |
Length match:117 |