chr16_1 | ||
cmsearch-Rfam |
||
Family :mir-194 |
Id:RF00257 |
Type:Gene; miRNA; |
Taxonomy:Eukaryota; | Ontology:GO:0035195 gene silencing by miRNARF00257 |
|
Description:Expression of miR-194 has been verified in mouse (MIR:MI0000236, MIR:MI0000733) [1] and human (MIR:MI0000488, MIR:MI0000732) [2].miR-194 appears to be a vertebrate specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF:MIPF0000055). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation -- their extents are not known. In this case the mature sequence is excised from the 5' arm of the hairpin. | ||
Score:32.3 |
E-value:0.00029 |
|
From sequence:474813 |
To sequence:474892 |
|
Alignments: NC | ||
RNAfold |
||
>chr16_1 GCACCGGCUCACUGGUGGCAGCAGCAGUGGCGAUGUUCUUAAAACGACUC CAGCCGCUGCUGCUGCCACCAGUGGCGCCGCUUUC ....(((((((((((((((((((((((((((...(((........)))....))))))))))))))))))))))).))))..... (-59.80) |
||
Length sequence: 85 |
Length match:78 |