chr17_5 | ||
cmsearch-Rfam |
||
Family :mir-156 |
Id:RF00073 |
Type:Gene; miRNA; |
Taxonomy:Eukaryota; | Ontology:GO:0035195 gene silencing by miRNARF00073 |
|
Description:This family represents the plant microRNA (miRNA) precursor mir-156. This miRNA has now been predicted orexperimentally confirmed in a range of plant species (MIPF:MIPF0000008). Animal miRNAs are transcribed as ~70nt precursors and subsequently processed by the Dicer enzyme to give a ~22nt product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA. | ||
Score:40.7 |
E-value:5.6e-06 |
|
From sequence:570798 |
To sequence:570882 |
|
Alignments: v v NC | ||
RNAfold |
||
>chr17_5 GCAUGCAGAGCGGGUGGGCGCGCAGGUGAGGCAAUGGCGUGUGUGUGUGU GUGUGUGUAGGUGUGCGCGCCCACCCGCUCUGCAUGCA ((((((((((((((((((((((((....(.(((...(((........)))...))).).....)))))))))))))))))))))))). (-61.90) |
![]() |
|
Length sequence: 88 |
Length match:83 |