| chr23_2 | ||
cmsearch-Rfam |
||
Family :ACEA_U3 |
Id:RF01848 |
Type:Gene; snRNA; snoRNA; CD-box; |
Taxonomy:Eukaryota; | Ontology:GO:0006396 RNA processingRF01848 |
|
Description:Small nucleolar RNAs (snoRNAs) are involved in the processing and modification of rRNA in the nucleolus.There are two main classes of snoRNAs: the box C/D class, and the box H/ACA class. U3 snoRNA is a member of the box C/D class. Indeed, the box C/D element is a subset of the six short sequence elements found in all U3 snoRNAs, namely boxes A, A', B, C, C', and D. The U3 snoRNA secondary structure is characterised by a small 5' domain (with boxes A and A'), and a larger 3' domain (with boxes B, C, C', and D), the two domains being linked by a single-stranded hinge. Boxes B and C form the B/C motif, which appears to be exclusive to U3 snoRNAs, and boxes C' and D form the C'/D motif. The latter is functionally similar to the C/D motifs found in other snoRNAs. The 5' domain and the hinge region act as a pre-rRNA-binding domain. The 3' domain has conserved protein-binding sites. Both the box B/C and box C'/D motifs are sufficient for nuclear retention of U3 snoRNA. The box C'/D motif is also necessary for nucleolar localisation, stability and hyper-methylation of U3 snoRNA. Both box B/C and C'/D motifs are involved in specific protein interactions and are necessary for the rRNA processing functions of U3 snoRNA. | ||
Score:68.5 |
E-value:2.1e-12 |
|
From sequence:216638 |
To sequence:216496 |
|
Alignments: vv vv NC | ||
RNAfold |
||
| >chr23_2 ACCUCCACGGCGGGAAGGUGGAACGGCGAAACGAAAAGGAUCCUUCUGGA ACUCUCUCCUGCCGUUCAUCGAAACGCUCUCCGGGCGGAGAAAGCAACCG UCAUCAUCAGGAUGUGAAACUCGGUUUCUUUUCAAUUAAGAGGUUGUACU CAUAAAACGAUUCUGUUCAGAGUACGGUCUUGCUUUGAGAAGGACGGAUC CACGCGAAGAAAUGCAUUUU .......((((((((.((.(...(((.((..(.....)..))...)))...).)).))))))))(((.(((....(((((((....)))))..)).((((...((((......))))....))))((((((((((....((((((((((((....((((....))))..))))))))))))...))))))))))((......))))).)))......... (-60.60) |
![]() |
|
Length sequence: 220 |
Length match:141 |
|