chr24_23 | ||
cmsearch-Rfam |
||
Family :U6 |
Id:RF00026 |
Type:Gene; snRNA; splicing; |
Taxonomy:Eukaryota; Viruses; | Ontology:GO:0000353 formation of quadruple SL/U4/U5/U6 snRNPRF00026 |
|
Description:U6 snRNA is a component of the spliceosome which is involved in splicing pre-mRNA. The putativesecondary structure consensus base pairing is confined to a short 5' stem loop, but U6 snRNA is thought to form extensive base-pair interactions with U4 snRNA [2]. This model hits a large number of sequences in vertebrate genomes, which appear to be U6 derived pseudogenes or repeats. This family has a high significance threshold to minimise this problem, but many annotated pseudogenes remain. | ||
Score:61.9 |
E-value:2.5e-13 |
|
From sequence:600346 |
To sequence:600249 |
|
Alignments: v v NC | ||
RNAfold |
||
>chr24_23 GGAAAAGCUAUAUCUCUCGAAGAUUGACAUCAGCCUUGCGCAGGGAGAGU GCUAAUCUUCUCUGUUGAAUUUCCAGUUUGUGGAUGUCCCCCGAAGGGGC UCC (((((..(.(((......((((((((.(((...((((....))))...))).))))))))..))).)..))))).......(((.(((((.....)))))))) (-25.60) |
![]() |
|
Length sequence: 103 |
Length match:96 |