chr31_1 | ||
cmsearch-Rfam |
||
Family :5_8S_rRNA |
Id:RF00002 |
Type:Gene; rRNA; |
Taxonomy:Eukaryota; Bacteria; Viruses; Archaea; | Ontology:GO:0003735 structural constituent of ribosomeRF00002 |
|
Description:5.8S ribosomal RNA (5.8S rRNA) is a component of the large subunit of the eukaryotic ribosome.It is transcribed by RNA polymerase I as part of the 45S precursor that also contains 18S and 28S rRNA. Functionally, it is thought that 5.8S rRNA may be involved in ribosome translocation [2]. It is also known to form covalent linkage to the p53 tumour suppressor protein [3]. 5.8S rRNA is also found in archaea. | ||
Score:29.7 |
E-value:0.00011 |
|
From sequence:267569 |
To sequence:267449 |
|
Alignments: v NC | ||
RNAfold |
||
>chr31_1 CUAUGAAAAAAGUGGUAGCCACUAAGGAGGUGCACGACUUCAACGCCCAC GCACACCGGUGCUGCCACUCUCGUUCUCUACCGCCUUUUGCGGCGUCCUU AGUCGUCAAAGAGCCAAGUCAGUCCGCACUUCACGUGCUGAAACGUCUCC ACGG ....(((...(((((((((.(((..((..((((.................)))).))))))))))))))....)))......((((((.(((((.......))))).)))).))....(((((.((.......)).)))))..(((....))). (-40.30) |
||
Length sequence: 154 |
Length match:119 |