chr31_18 | ||
cmsearch-Rfam |
||
Family :U2 |
Id:RF00004 |
Type:Gene; snRNA; splicing; |
Taxonomy:Eukaryota; | Ontology:GO:0045131 pre-mRNA branch point bindingRF00004 |
|
Description:U2 is a small nuclear RNA (snRNA) component of the spliceosome (involved in pre-mRNA splicing). Complementarybinding between U2 snRNA (in an area lying towards the 5' end but 3' to hairpin I) and the branchpoint sequence (BPS) of the intron results the bulging out of an unpaired adenosine, on the BPS, which initiates a nucleophilic attack at the intronic 5' splice site, thus starting the first of two transesterification reactions that mediate splicing. | ||
Score:79.1 |
E-value:7e-15 |
|
From sequence:251703 |
To sequence:251558 |
|
Alignments: NC | ||
RNAfold |
||
>chr31_18 AGAUGCUGUGCCCCGGGAAAAAAAAGAAGUUGCUCCCCUGGAAAGGUGGA GCUCCAGGGAAACAACCUCGACUUAUAAUUUCUAUUCCUUUGCCCGAAGG CAGUAUCAGGAGUUACUCUGAUAAGAACAGUUUAUAAACAUGAUCUUAGC UAAAUAGCCGAGAAGAUAUGCUACACGAGGCGUUCACAAAAGC ......(((..(((.(((.............((((((((....))).)))))))).)))..))).(((((.(((((.......(((((((((((....)))))....)))))).......))))).............((((.((((.(((....))).))))...)))).....)))))............. (-49.20) |
||
Length sequence: 193 |
Length match:144 |