chr5_2 | ||
cmsearch-Rfam |
||
Family :Bacteria_small_SRP |
Id:RF00169 |
Type:Gene; |
Taxonomy:Eukaryota; Bacteria; Archaea; | Ontology:GO:0006617 SRP-dependent cotranslational protein targeting to membrane, signal sequence recognitionRF00169 |
|
Description:The signal recognition particle (SRP) is a universally conserved ribonucleoprotein involved in the co-translational targeting ofproteins to membranes. The eukaryotic SRP consists of a 300-nucleotide 7S RNA (RFAM:RF00017) and six proteins: SRPs 72, 68, 54, 19, 14, and 9. Archaeal SRP consists of a 7S RNA and homologues of the eukaryotic SRP19 and SRP54 proteins. In most bacteria, the SRP consists of a 4.5S RNA and the Ffh protein (a homologue of the eukaryotic SRP54 protein). Some Gram-positive bacteria (e.g. Bacillus subtilis) have a longer eukaryote-like SRP RNA that includes an Alu domain [2]. The Alu domain of the longer SRP RNAs is not included in this model and therefore the reported bounds of some members are incorrect. The Signal Recognition Particle Database (SRPDB) [1] provides compilations of SRP components, with phylogenetic data and structural illustrations. | ||
Score:28.7 |
E-value:0.0048 |
|
From sequence:350158 |
To sequence:350104 |
|
Alignments: v v v v v v NC | ||
RNAfold |
||
>chr5_2 GGCGUGAUUCUGCAACGGCGGACGUGCGCAGGAUGGGCUGUUCCGUUUCC GGCCUGACCCGGUUUCCCUCGCUUCAACGGGUAGCCUACGACACCC ((.(((.((((((.(((.....)))..))))))((((((..((((((.((((......)))).............)))))).))))))...))))) (-29.40) |
||
Length sequence: 96 |
Length match:53 |