| chr5_3 | ||
cmsearch-Rfam |
||
Family :Metazoa_SRP |
Id:RF00017 |
Type:Gene; |
Taxonomy:Eukaryota; Archaea; | Ontology:GO:0006617 SRP-dependent cotranslational protein targeting to membrane, signal sequence recognitionRF00017 |
|
Description:The signal recognition particle (SRP) is a universally conserved ribonucleoprotein. It is involved in the co-translationaltargeting of proteins to membranes. The eukaryotic SRP consists of a 300-nucleotide 7S RNA and six proteins: SRPs 72, 68, 54, 19, 14, and 9. Archaeal SRP consists of a 7S RNA and homologues of the eukaryotic SRP19 and SRP54 proteins. Eukaryotic and archaeal 7S RNAs have very similar secondary structures, as represented by this family. Eight helical elements fold into the Alu and S domains, separated by a long linker region [1,2]. The Alu domain is thought to mediate the peptide chain elongation retardation function of the SRP [1]. The universally conserved helix which interacts with the SRP54 M domain mediates signal sequence recognition [2,3]. In eukaryotes and archaea, the SRP19-helix 6 complex is thought to be involved in SRP assembly and stabilises helix 8 for SRP54 binding [1]. The Signal Recognition Particle Database (SRPDB) [4] provides compilations of SRP components, with phylogenetic data and structural illustrations. Many sequences below the threshold for this family are clearly closely related, but are most likely to be SRP RNA derived pseudogenes. The human genome in particular is known to contain a large amount of SRP RNA related sequence, including Alu repeats. While the threshold of this family is set high so as to minimise the number of hits to such regions, it is likely that some remain. | ||
Score:61.1 |
E-value:2.3e-13 |
|
From sequence:350314 |
To sequence:350036 |
|
Alignments: vvv vvv vvvv vv v v v vvvv v v vv NC | ||
RNAfold |
||
| >chr5_3 GCGCCUCCGGAAAAGGUUUUGCGACGGCGCGUGGGGCUCAAGUGCGGUCA UGCUCCGCGGCGUGAUUCUGCAACGGCGGACGUGCGCAGGAUGGGCUGUU CCGUUUCCGGCCUGACCCGGUUUCCCUCGCUUCAACGGGUAGCCUACGAC ACCCCUCUACAGGGGGGCAGGCCACACCGACACACAGCCAAGCAGAGCAC CGCGUCAACGCAGCGCGCCACCCUCGCUGGUCCACGACACCCCCGCUCCA CCUAGGAAGCCCCCGAAGGUUACAGAGCAACGCUCCGGCUUGCAAAGCGC ((((..(((((....((((((.(((....((.((((((....((((((((((((....)))))))..)))))...((((..(((((..((((.((((((((.((....((((((.((.((((.(((..........))).)))).......(((((....)))))))))))))..)).))...)))))).(((.(((...(((((.......))))).....)))))).)))).)).)))..))))(((.....)))))))))))...))).)))))).....)))))........)))) (-109.70) |
![]() |
|
Length sequence: 300 |
Length match:277 |
|