chr5_33 | ||
cmsearch-Rfam |
||
Family :snoTBR17 |
Id:RF00294 |
Type:Gene; snRNA; snoRNA; CD-box; |
Taxonomy:Eukaryota; | Ontology:GO:0006396 RNA processingRF00294 |
|
Description:TBR17 is a member of the C/D class of snoRNA which contain the C (UGAUGA) andD (CUGA) box motifs. Most of the members of the box C/D family function in directing site-specific 2'-O-methylation of substrate RNAs [1,2]. | ||
Score:122.7 |
E-value:1.4e-30 |
|
From sequence:436434 |
To sequence:436554 |
|
Alignments: NC | ||
RNAfold |
||
>chr5_33 GCCUCGCGCGCGCCUGACGCACCGCCACGCGCCGCGGUUCCCGUUACGCA UAUCCUGUGUGCGCUCCAGCCCCGUCGGGGCCAUGACGAGUCCGCAACCA ACCAUGCGUUACACAUUGCC ...(((((.((((.((.((...)).)).))))))))).....((.((((((......((((.(((((((((((...)))))..))..)))).)))).......)))))).))........ (-40.30) |
||
Length sequence: 120 |
Length match:119 |