chr5_35 | ||
cmsearch-Rfam |
||
Family :snoTBR5 |
Id:RF00292 |
Type:Gene; snRNA; snoRNA; CD-box; |
Taxonomy:Eukaryota; | Ontology:GO:0006396 RNA processingRF00292 |
|
Description:TBR5 is a member of the C/D class of snoRNA which contain the C (UGAUGA) andD (CUGA) box motifs. Most of the members of the box C/D family function in directing site-specific 2'-O-methylation of substrate RNAs [1,2]. | ||
Score:35.6 |
E-value:8.1e-06 |
|
From sequence:437633 |
To sequence:437675 |
|
Alignments: v v NC | ||
RNAfold |
||
>chr5_35 CCGUGCGUGCCCGCCGCUGCGCGCUGACAUGAUCGACACCUAGGUUGAUG AAAGCCGUCGCAGAUGACAUGAGNNNNNNNNNNNNNNNNNNNNN .((.(((....)))))(((((((((......((((((......))))))...)).)).)))))............................... (-20.10) |
||
Length sequence: 94 |
Length match:41 |