chr5_36 | ||
cmsearch-Rfam |
||
Family :snoTBR7 |
Id:RF00295 |
Type:Gene; snRNA; snoRNA; CD-box; |
Taxonomy:Eukaryota; | Ontology:GO:0006396 RNA processingRF00295 |
|
Description:TBR7 is a member of the C/D class of snoRNA which contain the C (UGAUGA) andD (CUGA) box motifs. Most of the members of the box C/D family function in directing site-specific 2'-O-methylation of substrate RNAs [1,2]. | ||
Score:86.3 |
E-value:1.6e-16 |
|
From sequence:435882 |
To sequence:435954 |
|
Alignments: NC | ||
RNAfold |
||
>chr5_36 ACAGAUGAUGAUUGACUGUAACAUCACAGACUUUGAGUCGCGAUGAUAGC AACCAUGUCGCCCCAGUCUGACGUGC ...........(((.((((..((((.(.((((...))))).))))))))))).(((((((........))))))). (-16.20) |
![]() |
|
Length sequence: 76 |
Length match:71 |