gi_545778205_gb_U000_141 | ||
cmsearch-Rfam |
||
Family :mir-192 |
Id:RF00130 |
Type:Gene; miRNA; |
Taxonomy:Eukaryota; | Ontology:GO:0035195 gene silencing by miRNARF00130 |
|
Description:This family represents the human microRNA (miRNA) precursors mir-192 and mir-215. Animal miRNAs are transcribed as~70nt precursors and subsequently processed by the Dicer enzyme to give a ~22nt product. In this case the mature sequence comes from the 5' arm of the precursor. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA. The involvement of Dicer in miRNA processing suggests a relationship with the phenomenon of RNA interference. miRNAs are numbered based on the sequence of the mature RNA. | ||
Score:32.2 |
E-value:3.7e-05 |
|
From sequence:4171833 |
To sequence:4171732 |
|
Alignments: v v vvvv v v vvvv NC | ||
RNAfold |
||
>gi_545778205_gb_U000_141 UGCGAGAGUAGGGAACUGCCAGGCAUCAAAUAAAACGAAAGGCUCAGUCG AAAGACUGGGCCUUUCGUUUUAUCUGUUGUUUGUCGGUGAACGCUCUCCU GAGUA ...((((((.(...((((.((((((.((.((((((((((((((((((((....)))))))))))))))))))).)).)))))).))))...)))))))....... (-53.30) |
||
Length sequence: 105 |
Length match:100 |