| gi_545778205_gb_U000_16 |
cmsearch-Rfam |
Family : 6S |
Id: RF00013 |
Type: Gene; |
Taxonomy: Eukaryota; Bacteria; | Ontology: Not found |
 |
Description: E. coli 6S RNA was the first non coding RNA to be sequenced, but its function was unknown until recently. It consists of 184 nucleotides that fold into an extended hairpin structure with a large single-stranded internal bulge. The 6S RNA specifically associates with RNA polymerase holoenzyme containing the sigma70 specificity factor. This interaction represses expression from a sigma70-dependent promoter during stationary phase [1]. 6S RNA homologs have recently been identified in most bacterial genomes [2,3]. Many Gram-positive species have two copies of 6S RNA. In Bacillus subtilis, both copies appear to interact with RNA polymerase holoenzyme containing the housekeeping sigma factor and be expressed during different stages of growth. In many proteobacteria, 6S RNA may be processed from a transcript encoding homologs of the E. coli YgfA protein which is a putative methenyltetrahydrofolate synthetase. |
Score: 129.5 |
E-value: 1.5e-28 |
From sequence: 3055983 |
To sequence: 3056166 |
Alignments: v v v NC :<<<<<<<<<<<<<<-<<<-------------<<<<-<<<<<<----------------.<<<-<<<<<----<<<<<<<- CS RF00013 1 aaauccCUGcggUGUUCGucAguugcuuauaaguccCUGAgCCgAuaauuUuuuuaauu.GGGagcccuaucUuucaagug 80 A :UC:CUG:G:UGUUCG: AG +G++ A :CCCUGAGCCGAUA UU U+ A++ G::+G:: : ++ ::C:::UG gi_545778205_gb_U000 3055983 AUUUCUCUGAGAUGUUCGCAAGCGGGCCAG--UCCCCUGAGCCGAUAUUUCAUACCACAaGAAUGUGGCGCUCCGCGGUUG 3056061 ******************************..79999******************************************** PP
v v NC ----<<---<<<<<______>>>>>-->>----->>>>>>>-->>>>>->>>------------->>>>>>->>>>----- CS RF00013 81 GuGuGcAaGCCuggCUUGuAccaGGAAgCcuaAAacuugaaacagggcaCCCACCUggaAcagCaGGuUCAAggacuuaau 161 GUG+GCA+GC::GG +GU CC::GAAGCCU AAA:::G::AC: ::CA::CACCU+GAAC+ +GGUUCAAGG: UA++ gi_545778205_gb_U000 3056062 GUGAGCAUGCUCGGUCCGU-CCGAGAAGCCUUAAAACUGCGACGACACAUUCACCUUGAACCAAGGGUUCAAGGGU-UACA 3056140 *******************.****************************************************9997.8899 PP
v NC -------->>>>>>>>>>>>>>>>>:: CS RF00013 162 gacgaCaaaCGGCAccgCGGggauuuu 188 G C C :CGGCA:C:CGG:GA: ++ gi_545778205_gb_U000 3056141 GCCUGCG-GCGGCAUCUCGGAGAUUCC 3056166 9999999.******************* PP
|
RNAfold |
>gi_545778205_gb_U000_16 AAUUUCUCUGAGAUGUUCGCAAGCGGGCCAGUCCCCUGAGCCGAUAUUUC AUACCACAAGAAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUCCGUC CGAGAAGCCUUAAAACUGCGACGACACAUUCACCUUGAACCAAGGGUUCA AGGGUUACAGCCUGCGGCGGCAUCUCGGAGAUUCCCU ....((((((((((((.(((..((((((....(((.((((((.....((((........(((((((.((...(((((((..((((....(((((.....)))))....)))).))))))).)).)))))))....)))).....)))))).))).....)))))).)))))))))))))))...... (-80.10) |
 |
Length sequence: 187 |
Length match: 182 |