| gi_545778205_gb_U000_162 |
cmsearch-Rfam |
Family : P26 |
Id: RF00630 |
Type: Gene; |
Taxonomy: Eukaryota; Bacteria; | Ontology: Not found |
 |
Description: This small RNA (sRNA) was computationally identified in the genome of the opportunistic pathogen Pseudomonas aeruginosa and its expression verified by northern blot analysis [1]. P26 is conserved across many Gammaproteobacteria species and appears to be consistently located between the DNA directed RNA polymerase (beta subunit) and 50S ribosomal protein L7/L12 genes. There are two eukaryotic sequences (AAGJ02000785.1 and AAAB01036679.1) included in this alignment which appear to be contamination. |
Score: 32.4 |
E-value: 0.00014 |
From sequence: 2664305 |
To sequence: 2664252 |
Alignments: v v v v NC :::::::::::::<<<<<---<<____>>--->>>>>--<<<<<<<<<<______>>>>>>>>>>: CS RF00630 1 aacuUUgaGuuugCAGCCuGAGcuuuagCaaAGGCUGAUGGCuGGUGgCUUUUUAGcCACCgGCCU 66 ++ UUU G U GCCUGA A AGGC A GGC GGUG: U U :CACC GCCU gi_545778205_gb_U000 2664305 GUAUUUCGGAAUAGCGCCUGA-----A----AGGCG-AGGGCGGGUGAGUGAU--AUCACCCGCCU 2664252 *********************.....5....9****.****************..*********** PP
>> |
RNAfold |
>gi_545778205_gb_U000_162 GACUCAGGCGGGUGAUAUCACUCACCCGCCCUCGCCUUUCAGGCGCUAUU CCGAAAUACUUCCUC ......(((((((((......)))))))))..(((((...))))).................... (-25.50) |
 |
Length sequence: 65 |
Length match: 52 |