gi_545778205_gb_U000_163 |
cmsearch-Rfam |
Family : P26 |
Id: RF00630 |
Type: Gene; |
Taxonomy: Eukaryota; Bacteria; | Ontology: Not found |
|
Description: This small RNA (sRNA) was computationally identified in the genome of the opportunistic pathogen Pseudomonas aeruginosa and its expression verified by northern blot analysis [1]. P26 is conserved across many Gammaproteobacteria species and appears to be consistently located between the DNA directed RNA polymerase (beta subunit) and 50S ribosomal protein L7/L12 genes. There are two eukaryotic sequences (AAGJ02000785.1 and AAAB01036679.1) included in this alignment which appear to be contamination. |
Score: 74.1 |
E-value: 4e-15 |
From sequence: 4180930 |
To sequence: 4180991 |
Alignments: NC :::::::::::::<<<<<---<<____>>--->>>>>--<<<<<<<<<<______>>>>>>>>>>: CS RF00630 1 aacuUUgaGuuugCAGCCuGAGcuuuagCaaAGGCUGAUGGCuGGUGgCUUUUUAGcCACCgGCCU 66 A C+UU +G UUGCAGCCUGAG: +A:C AGGCUGAUGGC:GGUG:CUUUUUAG:CACC:GCCU gi_545778205_gb_U000 4180930 ACCCUUCCGGUUGCAGCCUGAGA--AAUC--AGGCUGAUGGCUGGUGACUUUUUAGUCACCAGCCU 4180991 *********************99..9999..*********************************** PP
>> |
RNAfold |
>gi_545778205_gb_U000_163 AACCCUUCCGGUUGCAGCCUGAGAAAUCAGGCUGAUGGCUGGUGACUUUU UAGUCACCAGCCUUU ((((.....)))).((((((((....))))))))..(((((((((((....)))))))))))... (-37.80) |
|
Length sequence: 65 |
Length match: 60 |