gi_545778205_gb_U000_164 |
cmsearch-Rfam |
Family : P26 |
Id: RF00630 |
Type: Gene; |
Taxonomy: Eukaryota; Bacteria; | Ontology: Not found |
|
Description: This small RNA (sRNA) was computationally identified in the genome of the opportunistic pathogen Pseudomonas aeruginosa and its expression verified by northern blot analysis [1]. P26 is conserved across many Gammaproteobacteria species and appears to be consistently located between the DNA directed RNA polymerase (beta subunit) and 50S ribosomal protein L7/L12 genes. There are two eukaryotic sequences (AAGJ02000785.1 and AAAB01036679.1) included in this alignment which appear to be contamination. |
Score: 26.0 |
E-value: 0.006 |
From sequence: 4181015 |
To sequence: 4180964 |
Alignments: v v NC :::::::::::::<<<<<---<<____>>--->>>>>--<<<<<<<<<<______>>>>>>>>>>: CS RF00630 1 aacuUUgaGuuugCAGCCuGAGcuuuagCaaAGGCUGAUGGCuGGUGgCUUUUUAGcCACCgGCCU 66 + +U G+G +U AGC GCAAA A GGC:GGUG:CU AG:CACC:GCC gi_545778205_gb_U000 4181015 CUACUGGCGCCUUA-----CAGC----GCAAA-----AAGGCUGGUGACUAAAAAGUCACCAGCCA 4180964 **********9995.....4688....88888.....***************************** PP
|
RNAfold |
>gi_545778205_gb_U000_164 GGCUGAUGGCUGGUGACUUUUUAGUCACCAGCCUUUUUGCGCUGUAAGGC GCCAGUAGCGUUUCA .((((..(((((((((((....))))))))))).....(((((....)))))...))))...... (-30.10) |
|
Length sequence: 65 |
Length match: 50 |