gi_545778205_gb_U000_190 | ||
cmsearch-Rfam |
||
Family :RNAI |
Id:RF00106 |
Type:Gene; antisense; |
Taxonomy:Eukaryota; Bacteria; Viruses; | Ontology:GO:0060910 negative regulation of DNA replication initiation involved in plasmid copy number maintenance |
|
Description:RNAI is an antisense repressor of the replication of some E. coli plasmids, including ColE1. Plasmidreplication is usually initiated by RNAII, which acts as a primer by binding to its template DNA. The complementary RNAI binds RNAII prohibiting it from its initiation role. The rate of degradation of RNAI is therefore a major factor in control of plasmid replication. This rate of degradation is aided by the pcnB (plasmid copy number B) gene product, which polyadenylates the 3' end of RNAI targeting it for degradation by PNPase. Please note: This family contains subsequences annotated as human (Z96734), Arabidopsis (AB003142), Xenopus (X91243) and S. pombe (L25927, L25928), which match with highly significant scores. These eukaryotic matches are almost certainly the result of vector contamination. | ||
Score:29.2 |
E-value:0.0035 |
|
From sequence:2653311 |
To sequence:2653385 |
|
Alignments: v v NC | ||
RNAfold |
||
>gi_545778205_gb_U000_190 UGGGGCGCGCGGGCAGAUUUACCGGUUGAGCCAGUGAAAUAAGUAUUUUA CAGGCAAUAAAAAACCGCCGAAUUUGGCGGUUUUUUAUUGCUAGUCUGGU UC ...(((..((.((........)).))...))).(((((((....))))))).((((((((((((((((((....)))))))))))))))))).......... (-38.20) |
||
Length sequence: 102 |
Length match:73 |