gi_545778205_gb_U000_191 | ||
cmsearch-Rfam |
||
Family :RNaseP_arch |
Id:RF00373 |
Type:Gene; ribozyme; |
Taxonomy:Bacteria; Archaea; | Ontology:GO:0008033 tRNA processingRF00373 |
|
Description:Ribonuclease P (RNase P) is a ubiquitous endoribonuclease, found in archaea, bacteria and eukarya as wellas chloroplasts and mitochondria. Its best characterised activity is the generation of mature 5'-ends of tRNAs by cleaving the 5'-leader elements of precursor-tRNAs. Cellular RNase Ps are ribonucleoproteins. RNA from bacterial RNase Ps retains its catalytic activity in the absence of the protein subunit, i.e. it is a ribozyme. Isolated eukaryotic and archaeal RNase P RNA has not been shown to retain its catalytic function, but is still essential for the catalytic activity of the holoenzyme. Although the archaeal and eukaryotic holoenzymes have a much greater protein content than the bacterial ones, the RNA cores from all the three lineages are homologous -- helices corresponding to P1, P2, P3, P4, and P10/11 are common to all cellular RNase P RNAs. Yet, there is considerable sequence variation, particularly among the eukaryotic RNAs. | ||
Score:47.3 |
E-value:1.2e-11 |
|
From sequence:3270581 |
To sequence:3270222 |
|
Alignments: v vvvvv v v v v NC | ||
RNAfold |
||
>gi_545778205_gb_U000_191 ACUGACCGAUAAGCCGGGUUCUGUCGUGGACAGUCAUUCAUCUAGGCCAG CAAUCGCUCACUGGCUCAAGCAGCCUACCCGGGUUCAGUACGGGCCGUAC CUUAUGAACCCCUAUUUGGCCUUGCUCCGGGUGGAGUUUACCGUGCCACG GACUGUUACCAGCCGCGCGGUGCGCUCUUACCGCACCCUUUCACCCUUAC CUGAUCCCGCUUGCGCGGGCCAUCGGCGGUUUGCUCUCUGUUGCACUGGU CGUGGGUUUCCCCCCCAGGCGUUACCUGGCACCCUGCCCUAUGGAGCCCG GACUUUCCUCCCCUCCGCCCGUCUCCCCCGAAGAGGACGACGACGAAGCG GCGACUGUC ..........(((((((((((((((...)))))...........((((((..........))))))..(((((((.....((((((((((((...)))))....)))))))......)))..)))).(((..(((((.((((((((...((.(((....))))))))))))).)))))..))).......(((........))).(((((....)))))((((.(((((..((((......(((.((((..(.(((....)))))))))))......))))..)))))..))))))))))).))).........((((.((((((..((.....))..)).))))..))))........ (-131.20) |
||
Length sequence: 359 |
Length match:358 |