gi_545778205_gb_U000_2 | ||
cmsearch-Rfam |
||
Family :5_8S_rRNA |
Id:RF00002 |
Type:Gene; rRNA; |
Taxonomy:Eukaryota; Bacteria; Viruses; Archaea; | Ontology:GO:0003735 structural constituent of ribosomeRF00002 |
|
Description:5.8S ribosomal RNA (5.8S rRNA) is a component of the large subunit of the eukaryotic ribosome.It is transcribed by RNA polymerase I as part of the 45S precursor that also contains 18S and 28S rRNA. Functionally, it is thought that 5.8S rRNA may be involved in ribosome translocation [2]. It is also known to form covalent linkage to the p53 tumour suppressor protein [3]. 5.8S rRNA is also found in archaea. | ||
Score:38.9 |
E-value:4.3e-08 |
|
From sequence:2729172 |
To sequence:2729019 |
|
Alignments: NC | ||
RNAfold |
||
>gi_545778205_gb_U000_2 UGGAUUCAGUUAAUGAUAGUGUGUCGAAACACACUGGGUUUCCCCAUUCG GAAAUCGCCGGUUAUAACGGUUCAUAUCACCUUACCGACGCUUAUCGCAG AUUAGCACGUCCUUCAUCGCCUCUGACUGCCAGGGCAUCCACCGUGUACG CUU ((((((((.....)))((((((((....))))))))(((((((......)))))))((((.......))))...............((((((.(((...))).)))..))).......(((.(((.....)))))))))))............ (-38.90) |
||
Length sequence: 153 |
Length match:152 |