gi_545778205_gb_U000_201 | ||
cmsearch-Rfam |
||
Family :ROSE_2 |
Id:RF01832 |
Type:Cis-reg; thermoregulator; |
Taxonomy:Eukaryota; Bacteria; | Ontology:GO:0040040 thermosensory behavior |
|
Description:This family represents a 5' UTR cis-regulatory element found in heat shock mRNAs and is knownas the ROSE (repression of heat shock gene expression) element. The ROSE element is a negative regulator of heat shock gene expression. The secondary structure is thought to be regulated by temperature. This regulation blocks access to the ribosome binding site under normal conditions. During heat shock however, the structure changes freeing the ribosome binding site and allowing expression to occur [1,2]. This family includes predicted members of the family from gamma-proteobacteria. | ||
Score:100.3 |
E-value:1.8e-23 |
|
From sequence:3867488 |
To sequence:3867416 |
|
Alignments: NC | ||
RNAfold |
||
>gi_545778205_gb_U000_201 ACGCAUAAUCAAUAGCUCCUGAAAUCAGCGAGAAUGUAAGACCUUCCACA AUGGACAGGUCAGGUAGCCAGA ...............((((((....))).))).......(((((((((...)))).)))))........... (-15.60) |
||
Length sequence: 72 |
Length match:71 |