gi_545778205_gb_U000_205 |
cmsearch-Rfam |
Family : RsmY |
Id: RF00195 |
Type: Gene; sRNA; |
Taxonomy: Bacteria; | Ontology: Not found |
 |
Description: The rsmY gene, like rsmZ (Rfam:RF00166), is regulated by the GacS/GacA signal transduction system in the plant-beneficial soil bacterium and biocontrol model organism Pseudomonas fluorescens CHA0. GacA/GacS target genes are translationally repressed by the small RNA binding protein RsmA. RsmY and RsmZ RNAs bind RsmA to relieve this repression and so enhance secondary metabolism and biocontrol traits [1]. |
Score: 21.8 |
E-value: 0.0074 |
From sequence: 2282820 |
To sequence: 2282843 |
Alignments: NC <<<<<<<<<<____>>>>>>>>>> CS RF00195 98 AaaaCCCCGCuucgGCGGGGuuuU 121 AAAACCCCGCU CGGCGGGGUUUU gi_545778205_gb_U000 2282820 AAAACCCCGCUCCGGCGGGGUUUU 2282843 ************************ PP
|
RNAfold |
>gi_545778205_gb_U000_205 CUGCAGCACAUCGACUUCGUUCGCGCUUAAUUGCUGAAUAAGUUGUAAAA AACCCCGCUCCGGCGGGGUUUUUUGUAUCUGCAGAUUAUGCCUGAUUACG GUAUUGCUAUUUUUUGCAGGC ((((((.....((((((.(((((.((......)))))))))))))(((((((((((((....)))))))))))))...)))))).....(((((.....((((....)))).....))))) (-46.60) |
 |
Length sequence: 121 |
Length match: 22 |