gi_545778205_gb_U000_211 | ||
cmsearch-Rfam |
||
Family :RtT |
Id:RF00391 |
Type:Cis-reg; |
Taxonomy:Eukaryota; Bacteria; | Ontology:Not found |
|
Description:This family represents a bacterial cis-regulatory element known as RtT RNA. The exact function of RtTis unknown although it is thought that it may be involved in changing the cellular response in relation to amino acid starvation [1]. | ||
Score:135.3 |
E-value:7.4e-31 |
|
From sequence:1287197 |
To sequence:1287066 |
|
Alignments: NC | ||
RNAfold |
||
>gi_545778205_gb_U000_211 GGUGGUGGGGGAAGGAUUACUCAGCGCUGCGCGCUUCGCCCUUCGGGUCG UUGCCUGCGGCAACGCUCUCUCGCUGGCGCUCGAGUCGAACCUUGGUCGA AGCUUCUCAUCCUUCCCCGCAUGGGCAGAAU (.(.(((((((((((((.(((((((((((.(((....((((...))))(((((((...)))))))......)))))))))).)))).(((.(((.....))).)))..)))))))))).))).).)..... (-54.80) |
![]() |
|
Length sequence: 131 |
Length match:130 |