gi_545778205_gb_U000_224 |
cmsearch-Rfam |
Family : RydC |
Id: RF00505 |
Type: Gene; sRNA; |
Taxonomy: Bacteria; | Ontology: Not found |
 |
Description: This family represents a bacterial non-coding RNA called RydC. RydC is thought to regulate an mRNA, yejABEF which encodes an ABC transporter protein. RydC is known to bind the protein Hfq which causes a conformational change in the RNA molecule. The Hfq/RydC complex is then thought to bind to the target mRNA and induce its degradation [1]. |
Score: 94.7 |
E-value: 2.6e-18 |
From sequence: 1491506 |
To sequence: 1491443 |
Alignments: NC :::::::::::<<<<<<<________________>>>>>>>::::::::::::::::::::::: CS RF00505 1 CUUCCGAUGUAGaCCCGUaUuCUUCGCCUGuacCACGGGuCgGuUUuaguaCAGGCGUUUUCUu 64 CUUCCGAUGUAGACCCGUAUUCUUCGCCUGUACCACGGGUCGGUUUUAGUACAGGCGUUUUCUU gi_545778205_gb_U000 1491506 CUUCCGAUGUAGACCCGUAUUCUUCGCCUGUACCACGGGUCGGUUUUAGUACAGGCGUUUUCUU 1491443 **************************************************************** PP
|
RNAfold |
>gi_545778205_gb_U000_224 AGAAAACGCCUGUACUAAAACCGACCCGUGGUACAGGCGAAGAAUACGGG UCUACAUCGGAAG ......(((((((((((...........))))))))))).......(((.......))).... (-17.60) |
 |
Length sequence: 63 |
Length match: 62 |