gi_545778205_gb_U000_227 | ||
cmsearch-Rfam |
||
Family :RyhB |
Id:RF00057 |
Type:Gene; sRNA; |
Taxonomy:Eukaryota; Bacteria; | Ontology:Not found |
|
Description:The RyhB 90-nt RNA down-regulates a set of iron-storage and iron-using proteins when iron is limiting;it is itself negatively regulated by the ferric uptake repressor protein, Fur (Ferric uptake regulator). RyhB RNA levels are inversely correlated with mRNA levels for the sdhCDAB operon, encoding succinate dehydrogenase, as well as five other genes previously shown to be positively regulated by Fur by an unknown mechanism. These include two other genes encoding enzymes in the tricarboxylic acid cycle, acnA and fumA, two ferritin genes, ftnA and bfr, and a gene for superoxide dismutase, sodB [1]. This ncRNA gene was recently identified in a screen and called SraI and was found to be expressed only in stationary phase [2]. | ||
Score:83.3 |
E-value:8.4e-16 |
|
From sequence:3580987 |
To sequence:3580923 |
|
Alignments: NC | ||
RNAfold |
||
>gi_545778205_gb_U000_227 AAAAAAAAGCCAGCACCCGGCUGGCUAAGUAAUACUGGAAGCAAUGUGAG CAAUGUCGUGCUUUCA .......(((((((.....))))))).........((((((((...(((......))))))))))) (-20.90) |
![]() |
|
Length sequence: 66 |
Length match:63 |