gi_545778205_gb_U000_228 |
cmsearch-Rfam |
Family : S15 |
Id: RF00114 |
Type: Cis-reg; leader; |
Taxonomy: Eukaryota; Bacteria; | Ontology: Not found |
|
Description: The E. coli Ribosomal S15 gene 5' UTR can form two alternative structures. One that is a series of three hairpins, The other includes a pseudoknot. This structure causes translational regulation of the S15 protein. The alignment of this family contains only the final two hairpins which are conserved in other species, and also includes the complete region that forms the alternate structures. |
Score: 115.6 |
E-value: 1.5e-28 |
From sequence: 3311742 |
To sequence: 3311628 |
Alignments: NC ::::::<<<<<<________>>>>>>--------------------<<<<<<<___________>>>>>>>:::::::::: CS RF00114 1 ugugaUcgCuGaAUUAGaGAuCgGcgaccauuuuuuuuuuuauuuuuuuGGaGUuauAaaAUGUCuCUaagUGcUGAAGaa 81 UG+GAUCGCUGAAUUAGAGAUCGGCG+CC+UU +U U+U+++U+ UUUGGAGUU+UAAAAUGUCUCUAAGU+CUGAAG+A gi_545778205_gb_U000 3311742 UGGGAUCGCUGAAUUAGAGAUCGGCGUCCUUUCAU--UCUAUAUACUUUGGAGUUUUAAAAUGUCUCUAAGUACUGAAGCA 3311664 ***********************************..******************************************** PP
NC :::::::::::::::::::::::::::::::::::: CS RF00114 82 AAAGCaaAAAUCGUUgCuGAaUUCGguCGuGauGaA 117 A AGC+AAAAUCGUU CUGA UU+GGUCGUGA+G+A gi_545778205_gb_U000 3311663 ACAGCUAAAAUCGUUUCUGAGUUUGGUCGUGACGCA 3311628 ************************************ PP
>> |
RNAfold |
>gi_545778205_gb_U000_228 UGCGUCACGACCAAACUCAGAAACGAUUUUAGCUGUUGCUUCAGUACUUA GAGACAUUUUAAAACUCCAAAGUAUAUAGAAUGAAAGGACGCCGAUCUCU AAUUCAGCGAUCCCAG .(((((.........(((.......(((..(((....)))..))).....))).(((((((..(((....)))...)))))))....))))).((((.((.....)).)))).... (-17.70) |
|
Length sequence: 116 |
Length match: 113 |