gi_545778205_gb_U000_229 |
cmsearch-Rfam |
Family : S15 |
Id: RF00114 |
Type: Cis-reg; leader; |
Taxonomy: Eukaryota; Bacteria; | Ontology: Not found |
|
Description: The E. coli Ribosomal S15 gene 5' UTR can form two alternative structures. One that is a series of three hairpins, The other includes a pseudoknot. This structure causes translational regulation of the S15 protein. The alignment of this family contains only the final two hairpins which are conserved in other species, and also includes the complete region that forms the alternate structures. |
Score: 22.8 |
E-value: 0.0078 |
From sequence: 4179932 |
To sequence: 4180052 |
Alignments: v v vvv vvv NC ::::::<<<<<<___.._____>>>>>>----------.----------<<<<<<<____._______>>>>>>>:::::: CS RF00114 1 ugugaUcgCuGaAUU..AGaGAuCgGcgaccauuuuuu.uuuuuauuuuuuuGGaGUuau.AaaAUGUCuCUaagUGcUGA 77 U G+U:G :: A U AG+GA :: C: + AUUUU U U ++A+ +U G AG +A+ +AAUG CU U U +U A gi_545778205_gb_U000 4179932 UCCGUUUGGAGGAGUgaAGUGAGUUCCAGAGAUUUUCUcUGGCAAACAUCCAGGAGCAAAgCUAAUGGCUUUAAAUCUUCA 4180012 *************************************877777777777778***************************** PP
NC :::::::::::::::::::::::::::::::::::::::: CS RF00114 78 AGaaAAAGCaaAAAUCGUUgCuGAaUUCGguCGuGauGaA 117 AGA AAA A++ AU GUUGCUGAA UC G ++G G+ gi_545778205_gb_U000 4180013 AGACAAACAAGCGAUUGUUGCUGAAGUCAGCGAAGUAGCC 4180052 **************************************** PP
|
RNAfold |
>gi_545778205_gb_U000_229 CCGUUUGGAGGAGUGAAGUGAGUUCCAGAGAUUUUCUCUGGCAAACAUCC AGGAGCAAAGCUAAUGGCUUUAAAUCUUCAAGACAAACAAGCGAUUGUUG CUGAAGUCAGCGAAGUAGCC ..((((.(((((.(((((......(((((((...))))))).......(((..(((...)))..))))))))..))))).))))......((.....((((((....))))))....)). (-34.50) |
|
Length sequence: 120 |
Length match: 119 |