gi_545778205_gb_U000_240 | ||
cmsearch-Rfam |
||
Family :SgrS |
Id:RF00534 |
Type:Gene; antisense; |
Taxonomy:Eukaryota; Bacteria; | Ontology:GO:0032057 negative regulation of translational initiation in response to stressRF00534 |
|
Description:In sugar transport-related sRNA (SgrS) is induced under conditions of glucose phosphate stress in E.coli. Thissmall RNA acts to negatively regulate the translation and stability of the ptsG mRNA, which encodes the major glucose transporter in E. coli [2]. SgrS forms a specific ribonucleoprotein complex with RNAse E and the chaperone Hfq and acts by base pairing with the ptsG mRNA. The crucial base-pairs for action of SgrS are confined to the 6 nt region overlapping the Shine-Dalgarno sequence of the ptsG mRNA [3]. | ||
Score:224.9 |
E-value:2.3e-65 |
|
From sequence:77367 |
To sequence:77593 |
|
Alignments: NC | ||
RNAfold |
||
>gi_545778205_gb_U000_240 ACGAUGAAGCAAGGGGGUGCCCCAUGCGUCAGUUUUAUCAGCACUAUUUU ACCGCGACAGCGAAGUUGUGCUGGUUGCGUUGGUUAAGCGUCCCACAACG AUUAACCAUGCUUGAAGGACUGAUGCAGUGGGAUGACCGCAAUUCUGAAA GUUGACUUGCCUGCAUCAUGUGUGACUGAGUAUUGGUGUAAAAUCACCCG CCAGCAGAUUAUACCUGCUGGUUUUUUUUAUU (((((((.(((.((.(((..((((((((((((((((((((((((.((((...(((....))))))).)))))))).((((.((((((.(((......))).))))))))))....)))))))))))).))))...))).(((.((........)).)))))))).)))).)))...........((((......)))).((((((((.......)))))))).......... (-78.70) |
||
Length sequence: 232 |
Length match:225 |