gi_545778205_gb_U000_241 | ||
cmsearch-Rfam |
||
Family :SIB_RNA |
Id:RF00113 |
Type:Gene; antitoxin; |
Taxonomy:Eukaryota; Bacteria; | Ontology:GO:0003729 mRNA binding |
|
Description:This family contains multiple ncRNA from E. coli that were identified in a large scale screenof E. coli, were they were called candidates 43,55 and 61 [1]. These RNAs have also been identified by other groups and called QUAD RNAs. | ||
Score:148.7 |
E-value:2.8e-33 |
|
From sequence:2153275 |
To sequence:2153423 |
|
Alignments: NC | ||
RNAfold |
||
>gi_545778205_gb_U000_241 UGACACUAAGGGCGGAGUGACAUAAUUUCAGGAGUGAGGGUUAGGGAGAG GUUUCCCCCUCCCCCUGGUGUUCUUAGUAAGCCUGGAAGCUAAUCACUAA GAGUAUCACCAGUAUGAUGACGUGCUUCAUCAUAACCCUUUCCUUAUU ...((((........))))..........((((..((((((..(((((.((....)).))))).((((((((((((((.(((......)))....))))))))...))))))((((((((......)))))))))))))))))).... (-49.40) |
![]() |
|
Length sequence: 148 |
Length match:147 |