gi_545778205_gb_U000_243 | ||
cmsearch-Rfam |
||
Family :SIB_RNA |
Id:RF00113 |
Type:Gene; antitoxin; |
Taxonomy:Eukaryota; Bacteria; | Ontology:GO:0003729 mRNA binding |
|
Description:This family contains multiple ncRNA from E. coli that were identified in a large scale screenof E. coli, were they were called candidates 43,55 and 61 [1]. These RNAs have also been identified by other groups and called QUAD RNAs. | ||
Score:136.1 |
E-value:3.8e-30 |
|
From sequence:3056815 |
To sequence:3056965 |
|
Alignments: NC | ||
RNAfold |
||
>gi_545778205_gb_U000_243 UGACAUCGUUGAUUCUUUGACCUAAUUUAGUGAGUAAGGGUAAGGGAGGA UUGCUCCUCCCCUGAGACUGACUGUUAAUAAGCGCUGAAACUUAUGAGUA ACAGUACAAUCAGUAUGAUGACAAGUCGCAUCAUAACCCUUCUCCUUCAA .......(((((....))))).......((.(((.((((((..(((((((....)))))))((((.....((((((((((((........)))))...)))))))....))))(((((((........)))))))))))))))))).... (-44.10) |
||
Length sequence: 150 |
Length match:149 |