gi_545778205_gb_U000_263 |
cmsearch-Rfam |
Family : Spot_42 |
Id: RF00021 |
Type: Gene; sRNA; |
Taxonomy: Eukaryota; Bacteria; | Ontology: Not found |
|
Description: The physiological role of Escherichia coli Spot 42 (spf) RNA has remained obscure, even though the 109-nucleotide RNA was discovered almost three decades ago. Spot 42 seems to have a regulatory role on the galactose operon [1]. It is proposed that Spot 42 acts by an antisense mechanism where the RNA binds to the galK translation initiator region [1]. Changes in Spot 42 levels are implicated in affecting the adjacent DNA polymerase I levels [2]. The Hfq protein has been shown to interact with several small regulatory RNAs in E. coli, and the protein is required for OxyS, DsrA, RprA and Spot 42 RNA regulation [3].
|
Score: 122.0 |
E-value: 9.6e-26 |
From sequence: 4049889 |
To sequence: 4050007 |
Alignments: NC ::::::::<<<<-<<<<<-<<<<<<<<<<<<___>>>>>>---->>>>>>>>>>>->>>>,,,,,,,,,,<<<<<<_.... CS RF00021 1 aaUuaucggcGuAggguaCagaGGuaaGaugUUCuauCuuUCAGaCCuuuuaccucaCgcuAuuggAuuaGgCugau.... 77 A+UUA + :CGUAG:GUACAGAGGUAAGAUGUUCUAUCUUUCAGACCUUUUAC:UCACG:+AU GGAUU+GGCU:A+ gi_545778205_gb_U000 4049889 AGUUAGUCGCGUAGGGUACAGAGGUAAGAUGUUCUAUCUUUCAGACCUUUUACUUCACGUAAUCGGAUUUGGCUGAAuauu 4049969 ****************************************************************************88999 PP
NC >>>>>><<<<<<<<<<____>>>>>>>>>>:::::::: CS RF00021 78 ucaGcCGCCcCaGccaaUuuuggCuGgGGCuUUUUUUu 115 U:AGCCGCCCCAG:CA U +UG:CUGGGGC+UUUUUU+ gi_545778205_gb_U000 4049970 UUAGCCGCCCCAGUCAGUAAUGACUGGGGCGUUUUUUA 4050007 ************************************** PP
|
RNAfold |
>gi_545778205_gb_U000_263 GUUAGUCGCGUAGGGUACAGAGGUAAGAUGUUCUAUCUUUCAGACCUUUU ACUUCACGUAAUCGGAUUUGGCUGAAUAUUUUAGCCGCCCCAGUCAGUAA UGACUGGGGCGUUUUUUA ...((((((((.(((((.((((((((((((...))))))....))))))))))).)))).....)))).(((((((...)))))))((((((((((....))))))))))........ (-43.20) |
|
Length sequence: 118 |
Length match: 117 |