gi_545778205_gb_U000_34 | ||
cmsearch-Rfam |
||
Family :Cobalamin |
Id:RF00174 |
Type:Cis-reg; riboswitch; |
Taxonomy:Eukaryota; Bacteria; Viruses; | Ontology:GO:0031419 cobalamin binding |
|
Description:Riboswitches are metabolite binding domains within certain messenger RNAs that serve as precision sensors for theircorresponding targets. Allosteric rearrangement of mRNA structure is mediated by ligand binding, and this results in modulation of gene expression [1]. This family represents a cobalamin riboswitch (B12-element) which is widely distributed in 5' UTRs of vitamin B(12)-related genes in bacteria. Cobalamin in the form of adenosylcobalamin (Ado-CBL) is known to repress expression of genes for vitamin B(12) biosynthesis and be transported by a post-transcriptional regulatory mechanism, which involves direct binding of Ado-CBL to 5' UTRs [2]. | ||
Score:98.3 |
E-value:7.2e-26 |
|
From sequence:4163384 |
To sequence:4163574 |
|
Alignments: v v v v NC | ||
RNAfold |
||
>gi_545778205_gb_U000_34 UGUAGCAUCCACUUGCCGGUCCUGUGAGUUAAUAGGGAAUCCAGUGCGAA UCUGGAGCUGACGCGCAGCGGUAAGGAAAGGUGCGAUGAUUGCGUUAUGC GGACACUGCCAUUCGGUGGGAAGUCAUCAUCUCUUAGUAUCUUAGAUACC CCUCCAAGCCCGAAGACCUGCCGGCCAACGUCGCAUCUGG ...........(((((((...(((((.(((.....((..(((((.......))))).))))).))))))))))))...((((((((((.((((((...)))(((.(((((....)))))...)))...........(((((...)))))........(((.(........).)))))))))))))))).. (-53.50) |
![]() |
|
Length sequence: 190 |
Length match:189 |