gi_545778205_gb_U000_346 |
cmsearch-Rfam |
Family : t44 |
Id: RF00127 |
Type: Gene; sRNA; |
Taxonomy: Eukaryota; Bacteria; | Ontology: Not found |
|
Description: This family consists of a number of bacterial RNA genes of between 135 and 170 bases in length. The t44 gene has been identified in several species of enteric bacteria but homologs have also been identified in Pseudomonas and Coxiella species. The t44 gene is found between the map and rpsB genes in all species in the full alignment apart from Shigella flexneri. The function of this RNA is unknown. |
Score: 83.0 |
E-value: 2.2e-19 |
From sequence: 189760 |
To sequence: 189846 |
Alignments: v v NC ::::::::::::::::::::::<<<<<<<<----<<<<<<<<<----<<<<<____________>>>>>>>>>.>>>>>->>> CS RF00127 1 cUuauuuuauuuaaAaaaCACACACguauCGaCACaugcgcCgGGGUGCcccuauuuuagaaaagggGUcGgc.gcauGGGau 82 CU+A UUU+U U AA AACACACACGUAUCG CACAU:: CCGGGGUGCCC:U+ :GGGUCGG ::AUGGGAU gi_545778205_gb_U000 189760 CUCACUUUGUGU-AACAACACACACGUAUCGGCACAUAUUCCGGGGUGCCCUUU----------GGGGUCGGUaAUAUGGGAU 189831 ******888865.899************************************99..........********99********* PP
NC >>>>>:::::::::: CS RF00127 83 acGUGGAGGCuUAAC 97 ACGUGGAGGC+UAAC gi_545778205_gb_U000 189832 ACGUGGAGGCAUAAC 189846 *************** PP
|
RNAfold |
>gi_545778205_gb_U000_346 CAAUCUCACUUUGUGUAACAACACACACGUAUCGGCACAUAUUCCGGGGU GCCCUUUGGGGUCGGUAAUAUGGGAUACGUGGAGGCAUAACCCCAA ...((((....(((((....)))))((((((((..(.(((((((((....((((....))))))).)))))))))))))))))))........... (-28.80) |
|
Length sequence: 96 |
Length match: 85 |