gi_545778205_gb_U000_35 |
cmsearch-Rfam |
Family : CPEB3_ribozyme |
Id: RF00622 |
Type: Gene; ribozyme; |
Taxonomy: Eukaryota; | Ontology: Not found |
 |
Description: The mammalian CPEB3 ribozyme is a self cleaving RNA located in the second intron of the CPEB3 gene which belongs to a family of genes regulating messenger RNA polyadenylation [1]. This ribozyme is highly conserved and found only in mammals [1]. The CPEB3 ribozyme is structurally and biochemically related to the human hepatitis delta virus (HDV) ribozyme (Rfam:RF00094) and the HDV ribozyme is proposed to have arisen from the human transcriptome [1]. There is currently only one other known self cleaving ribozyme in mammals, the CoTC motif (Rfam:RF00621)[2]. |
Score: 22.1 |
E-value: 0.003 |
From sequence: 258828 |
To sequence: 258936 |
Alignments: v v v v NC ::::::::::::<<<<<----------<<<___~~~~~~>>>->>>>>---<<<<<<<____>>>>>>>::::::::::: CS RF00622 1 AGaGgAuAacagGGGGCCAcaGcAGAAGCGUUC*[ 4]*CGCGGCCCCUGUCAGAUUCugGuGAAUCUGCGAAUUCUGCu 78 G A AG::GG AC+G A AG:GUUC C:C CC:: GU AG UUC+ G GAA CU CG CUGCU gi_545778205_gb_U000 258828 UGUUCGAUAAAGCAGGCGACUGGAAGAGUGUUC*[35]*CACACCCUGCGUGAGUUUCACGAGAAGCUGCGUGAACUGCU 258936 *******************************98...*..***************************************** PP
|
RNAfold |
>gi_545778205_gb_U000_35 GUUCGAUAAAGCAGGCGACUGGAAGAGUGUUCCGGUAAAAGACACUGAAG UGGUUGAACGACUGGAGCACACCCUGCGUGAGUUUCACGAGAAGCUGCGU GAACUGCU .........((((((((.(.((....((((((((((....(((.(......)))).....))))))))))..)).))))....((((((........))))))))))) (-30.60) |
 |
Length sequence: 108 |
Length match: 107 |