gi_545778205_gb_U000_359 | ||
cmsearch-Rfam |
||
Family :TPP |
Id:RF00059 |
Type:Cis-reg; riboswitch; |
Taxonomy:Eukaryota; Bacteria; Archaea; | Ontology:GO:0030976 thiamine pyrophosphate binding |
|
Description:Vitamin B(1) in its active form thiamin pyrophosphate (TPP) is an essential coenzyme that is synthesisedby coupling of pyrimidine and thiazole moieties in bacteria. The previously detected thiamin-regulatory element, thi box [1] was extended, resulting in a new, highly conserved RNA secondary structure, the THI element, which is widely distributed in eubacteria and also occurs in some archaea. Analysis of operon structures identified a large number of new candidate thiamin-regulated genes, mostly transporters, in various prokaryotic organisms [2]. The THI element is a riboswitch [3] that directly binds to TPP to regulate gene expression through a variety of mechanisms in archaea, bacteria and eukaryotes [4,5]. | ||
Score:66.9 |
E-value:2.6e-12 |
|
From sequence:2185432 |
To sequence:2185336 |
|
Alignments: v v v NC | ||
RNAfold |
||
>gi_545778205_gb_U000_359 UGACCUGGUGGUCCGUGACUUCCCUACGCUGGCAUUAUCCAGAUCAGGUG AUACGGGUAUUUCUCAGCCUUCACGCAGAAGGGCACCCCGAGUCGUUUGG UUGC .((((....))))((((.......))))((((......))))((((((((((.((((..........(((((.....)))))....)))).))))))))))... (-28.10) |
||
Length sequence: 104 |
Length match:95 |