gi_545778205_gb_U000_384 | ||
cmsearch-Rfam |
||
Family :tRNA |
Id:RF00005 |
Type:Gene; tRNA; |
Taxonomy:Eukaryota; Bacteria; Viruses; Archaea; | Ontology:GO:0030533 triplet codon-amino acid adaptor activity |
|
Description:Transfer RNA (tRNA) molecules are approximately 80 nucleotides in length. Their secondary structure includes four shortdouble-helical elements and three loops (D, anti-codon, and T loops). Further hydrogen bonds mediate the characteristic L-shaped molecular structure. tRNAs have two regions of fundamental functional importance: the anti-codon, which is responsible for specific mRNA codon recognition, and the 3' end, to which the tRNAs corresponding amino acid is attached (by aminoacyl-tRNA synthetases). tRNAs cope with the degeneracy of the genetic code in two manners: having more than one tRNA (with a specific anti-codon) for a particular amino acid; and 'wobble' base-pairing, i.e. permitting non-standard base-pairing at the 3rd anti-codon position. | ||
Score:62.5 |
E-value:3.7e-13 |
|
From sequence:2520931 |
To sequence:2521003 |
|
Alignments: NC | ||
RNAfold |
||
>gi_545778205_gb_U000_384 GGUGAUUAGCUCAGCUGGGAGAGCACCUCCCUUACAAGGAGGGGGUCGGC GGUUCGAUCCCGUCAUCACCCA ((((((.(((...)))(((((.....))))).......((.(((((((......))))))).)))))))).. (-29.60) |
||
Length sequence: 72 |
Length match:71 |