gi_545778205_gb_U000_44 | ||
cmsearch-Rfam |
||
Family :CsrB |
Id:RF00018 |
Type:Gene; sRNA; |
Taxonomy:Eukaryota; Bacteria; | Ontology:GO:0005515 protein binding |
|
Description:The CsrB RNA binds to approximately 18 copies of the CsrA protein Pfam:PF02599. Although CsrA proteinsare found in a wide variety of bacteria, CsrB RNAs are only known in enterobacter. The CsrB RNAs contain a conserved motif CAGGXXG that is found in up to 18 copies and has been suggested to bind CsrA. The Csr regulatory system has a strong negative regulatory effect on glycogen biosynthesis, glyconeogenesis and glycogen catabolism and a positive regulatory effect on glycolysis [1]. In other bacteria such as Erwinia caratovara the RsmA protein has been shown to regulate the production of virulence determinants, such extracellular enzymes [2]. RsmA binds to RsmB regulatory RNA which is also a member of this family [2]. | ||
Score:376.7 |
E-value:1.4e-110 |
|
From sequence:2924515 |
To sequence:2924156 |
|
Alignments: NC | ||
RNAfold |
||
>gi_545778205_gb_U000_44 AUAAAAAAAGGGAGCACUGUAUUCACAGCGCUCCCGGUUCGUUUCGCAGC AUUCCAGCUACUUUUGUUGCUCCCUGCUCAUCCUUGACAACUUUUCCUCU GGCCUUGCGGCCAAUCGUUCAUCCUGAACUAUUGCUUCCUGCUCACACCA CCCCGAUGUGAUACUUCAUCCUGAAGUGUCCCUGGCCUUCCUGACCCACC GAAUCAUCCUGACCGGUUCUCAUUCUCCAUCCUGGAGGUGUCCUUUAACG CGUCCUGCGUCAUCCUCUUCGCUUCAUCCAGAAGCCUUUCCCUGAAACAC CAUCCUGGUGUGUCCUGCAGAAGUGUCAUCAUCCUGAUGUUCACUUCGUU GUCUGACUC .........((((((.((((....)))).))))))............((((....(((.((....)).)))...)))).......((((((........(((((....)))))...(((((...)))))....((.....))..(((((.((..((((.(((((((((...)))))))))...((.(.....).)).((((..(((...))).))))..........))))..)).)))))......((((.....))))..........(((((.....)))))........((.((((((...)))))).)).....((((((.(((((...)))))..))))))))))))...... (-98.10) |
||
Length sequence: 359 |
Length match:358 |