Description: The 245 nucleotide sRNA of Escherichia coli, CsrC, was discovered using a genetic screen for factors that regulate glycogen biosynthesis. CsrC RNA binds multiple copies of CsrA Pfam:PF02599, a protein that post-transcriptionally regulates central carbon flux, biofilm formation and motility in E. coli. CsrC antagonises the regulatory effects of CsrA, presumably by sequestering this protein. The discovery of CsrC is intriguing, in that a similar sRNA, CsrB, performs essentially the same function. Both sRNAs possess similar imperfect repeat sequences (18 in CsrB, nine in CsrC), primarily localised in the loops of predicted hairpins, which may serve as CsrA binding elements. Transcription of csrC increases as the culture approaches the stationary phase of growth and is indirectly activated by CsrA via the response regulator UvrY [1]. This RNA was also discovered in E. coli during a large scale screen [2]. The gene called SraK, was highly abundant in stationary phase, but low levels could be detected in exponentially growing cells as well [2]. |
Alignments: NC ::::<<<<____>>>>,,,,,,,,,,,<<<<<<_______>>>>>>,,,,<<<<____>>>>,,<<<<______>>>>,,, CS RF00084 1 auAugGCgaGGAcGCcaacAGGAUuAacGaCccAGGAuGAggGuCgGgAGCGCCAGGAGGCGAAgaccCAGGAUggucAGG 81 AUA :GCGAGGACGC:AACAGGA +AA:GAC:CAGGAUGAG:GUC:GGAGCGCCAGGAGGCGAAGAC: AGGAU:GUCAGG gi_545778205_gb_U000 4051036 AUAGAGCGAGGACGCUAACAGGAACAAUGACUCAGGAUGAGGGUCAGGAGCGCCAGGAGGCGAAGACAGAGGAUUGUCAGG 4051116 ********************************************************************************* PP
NC ,,,,,,,<<<<<____>>>>>,,,,,,,,,,,,,,,,,,,<<<<<<<--<<<<<<<________>>>--->>>>-->>>>> CS RF00084 82 AaGACaaaCGuCuGGAGaCGuUauuAaAaGGAAAuGGAAacgacccgGacuGuuccAcGCUAAgggaaAaaCagGGcgggu 162 AAGACAAACGUC+GGAGACGU AUUAAA GGAAAUGGAA C:AC:C:GA UGUUCC +GCUAA+GGAAAAACA GG:G:GU gi_545778205_gb_U000 4051117 AAGACAAACGUCCGGAGACGUAAUUAAACGGAAAUGGAAUCAACACGGAUUGUUCC-GGCUAAAGGAAAAACAGGGUGUGU 4051196 ********************************************************.************************ PP
NC >>,,,,,,,<<_______>>,,,<<<<_____>>>>,,,,,,,,,,<<<<<<<<<<<<<<<<____>>>>>>>>>>>>>>> CS RF00084 163 cguUaGCgAaCAGGGAuaGuagAaCCCGUUaAGGGugGUgAGUcAaGaaaaaaGGCGaCaGauUacuCuGuCGCCuuuuuu 243 :G GC CA GGAU+G A+ ACCCGUUAAGGGU UGAGUCA+GAAAAAAGGCGACAGA UA+UCUGUCGCCUUUUUU gi_545778205_gb_U000 4051197 UGGCGGCCUGCAAGGAUUGUAAGACCCGUUAAGGGUUAUGAGUCAGGAAAAAAGGCGACAGAGUAAUCUGUCGCCUUUUUU 4051277 ********************************************************************************* PP
NC >::::::::::: CS RF00084 244 CUUUGCUUGCUU 255 CUUUGCUUGCUU gi_545778205_gb_U000 4051278 CUUUGCUUGCUU 4051289 ************ PP
>> |