gi_545778205_gb_U000_487 | ||
cmsearch-Rfam |
||
Family :yybP-ykoY |
Id:RF00080 |
Type:Cis-reg; |
Taxonomy:Eukaryota; Bacteria; | Ontology:Not found |
|
Description:This RNA was originally discovered in E. coli during a large scale screen and was namedSraF [1]. The family was later found to exist upstream of related families of protein genes in many bacteria, including the the yybP and ykoK genes in B. subtilis. The specific functions of these proteins are unknown, but this structured RNA element may be involved in their genetic regulation as a riboswitch [2]. | ||
Score:41.3 |
E-value:4e-09 |
|
From sequence:1905456 |
To sequence:1905557 |
|
Alignments: NC | ||
RNAfold |
||
>gi_545778205_gb_U000_487 CAACAGUUGUUUUAUAUUCUCAAAAUAUGUUAAGGUUGCGCCCUCAUUUG GGGAGUAGCCGAUUUCCAGAUUCCGGAAAUGUACGUGUCAACAUACUCGU UGCAAAACGUGGCACGUACGGACUGAAUACUUUCAGUCAGGCGAGACCAU AUGCACAUCAAUCGCUAUGCCUGCA ...(((.((((((........))))))......((((((.((((.....)))).)))))).((((((.......))))))((((((((((.......((((....)))))))))))))).(((((((....))))))).(((((.................)))))....))).. (-51.50) |
![]() |
|
Length sequence: 175 |
Length match:100 |