gi_545778205_gb_U000_49 |
cmsearch-Rfam |
Family : ctRNA_p42d |
Id: RF00489 |
Type: Gene; antisense; |
Taxonomy: Eukaryota; Bacteria; | Ontology: Not found |
|
Description: This family represents a group of ctRNAs (or counter-transcribed RNAs) from p42d and related plasmids. ctRNAs are small, highly structured, antisense sequences which are involved in negative regulation. Members of this family are known to bind to the mRNA of repC causing translational repression [1]. This model contains the predicted stem-loop structure followed by a U-rich tract which is proposed to act as a Rho-independent transcriptional terminator. |
Score: 33.5 |
E-value: 2.5e-05 |
From sequence: 1295355 |
To sequence: 1295319 |
Alignments: NC ::::<<<<<<<<--~~~~~~>>>>>>>>::::::::::: CS RF00489 1 AGAAaGGCUUCCAC*[13]*GGGGGCCuUUUUCUUUUGC 46 A AA GGC:UCCAC GGG:GCC UUUUCUU UGC gi_545778205_gb_U000 1295355 AUAACGGCUUCCAC*[ 4]*GGGAGCCGUUUUCUUAUGC 1295319 ************98...7..******************* PP
>> |
RNAfold |
>gi_545778205_gb_U000_49 AGUGGCAUAAGAAAACGGCUCCCUGUUGUGGAAGCCGUUAUAGUGC ....((((.....(((((((.((......)).)))))))...)))) (-15.30) |
|
Length sequence: 46 |
Length match: 35 |