gi_545778205_gb_U000_51 |
cmsearch-Rfam |
Family : ctRNA_p42d |
Id: RF00489 |
Type: Gene; antisense; |
Taxonomy: Eukaryota; Bacteria; | Ontology: Not found |
|
Description: This family represents a group of ctRNAs (or counter-transcribed RNAs) from p42d and related plasmids. ctRNAs are small, highly structured, antisense sequences which are involved in negative regulation. Members of this family are known to bind to the mRNA of repC causing translational repression [1]. This model contains the predicted stem-loop structure followed by a U-rich tract which is proposed to act as a Rho-independent transcriptional terminator. |
Score: 26.9 |
E-value: 0.0021 |
From sequence: 848370 |
To sequence: 848335 |
Alignments: NC ::::<<<<<<<<~~~~~~>>>>>>>>::::::::::: CS RF00489 1 AGAAaGGCUUCC*[15]*GGGGGCCuUUUUCUUUUGC 46 A A GGCU:CC GG:GGCC UUUU UUUUGC gi_545778205_gb_U000 848370 AAAGCGGCUUCC*[ 5]*GGAGGCCGUUUUGUUUUGC 848335 ************...8..******************* PP
>> |
RNAfold |
>gi_545778205_gb_U000_51 GGCUGCAAAACAAAACGGCCUCCUGUCAGGAAGCCGCUUUUAUCG ...............((((.((((...)))).))))......... (-11.30) |
|
Length sequence: 45 |
Length match: 34 |