gi_545778205_gb_U000_53 |
cmsearch-Rfam |
Family : CyaR_RyeE |
Id: RF00112 |
Type: Gene; sRNA; |
Taxonomy: Eukaryota; Bacteria; Viruses; | Ontology: Not found |
|
Description: This sRNA was originally identified in a large scale screen of E. coli. It was shown to bind Hfq and called RyeE [1]. This sRNA has since been characterised as a post-transcriptional regulator of the 18 kDa OmpX porin in Salmonella [2]. Phylogenetic and mutational analyses suggest that a conserved RNA hairpin of this sRNA which features a C-rich apical loop, acts to sequester the Shine-Dalgarno sequence of ompX mRNA and inhibits translational initiation [2]. The expression of this sRNA has been shown to be tightly controlled by the cyclic AMP receptor protein, CRP and has been renamed CyaR (cyclic AMP-activated RNA)[2]. CyaR appears to be highly conserved amongst enterobacteria and the cyaR gene is frequently located downstream of the yegQ gene. |
Score: 99.7 |
E-value: 1.8e-20 |
From sequence: 2167112 |
To sequence: 2167197 |
Alignments: NC ::::::::::::::::::::::.:::::::::::::::<<<<______>>>>-<<<<<<<<<<<______>>>>>>>>>>> CS RF00112 1 ucGauuAAAAacAuaAaCuAaA.AAUguUAGcaauACuAGGAACCACCUCCUUgGCCcGcgcAAUCUCCCUUgcgCgGGCc 80 UCG+U+AAAAACAUAA+C+A+A AAUG+UAGC++UAC+AGGAACCACCUCCUU:GCC:G:G:AAUCUCCCUU:C:C:GGC: gi_545778205_gb_U000 2167112 UCGCUGAAAAACAUAACCCAUAaAAUGCUAGCUGUACCAGGAACCACCUCCUUAGCCUGUGUAAUCUCCCUUACACGGGCU 2167192 *********************9899999***************************************************** PP
NC ::::: CS RF00112 81 UuUUu 85 U+UUU gi_545778205_gb_U000 2167193 UAUUU 2167197 ***** PP
|
RNAfold |
>gi_545778205_gb_U000_53 CGCUGAAAAACAUAACCCAUAAAAUGCUAGCUGUACCAGGAACCACCUCC UUAGCCUGUGUAAUCUCCCUUACACGGGCUUAUUU .((((......................))))......((((......)))).(((((((((((......)))))))))))..... (-19.50) |
|
Length sequence: 85 |
Length match: 84 |