gi_545778205_gb_U000_57 | ||
cmsearch-Rfam |
||
Family :DnaX |
Id:RF00382 |
Type:Cis-reg; frameshift_element; |
Taxonomy:Eukaryota; Bacteria; | Ontology:Not found |
|
Description:This family represents a ribosomal frameshifting element found in the mRNA of the dnaX gene inE. coli. The dnaX gene has two encoded products tau and gamma which are produced in a 1:1 ratio. The gamma protein is synthesised due to programmed frameshifting and is shorter than tau. The two products of the dnaX gene are DNA polymerase III subunits [1,2]. | ||
Score:96.8 |
E-value:1e-21 |
|
From sequence:493356 |
To sequence:493420 |
|
Alignments: NC | ||
RNAfold |
||
>gi_545778205_gb_U000_57 GCAGGGAGCAACCAAAGCAAAAAAGAGUGAACCGGCAGCCGCUACCCGCG CGCGGCCGGUGAAU ((.((......))...))........((..((((((.(((((.....))).)).))))))..)) (-21.60) |
![]() |
|
Length sequence: 64 |
Length match:63 |