gi_545778205_gb_U000_58 |
cmsearch-Rfam |
Family : DsrA |
Id: RF00014 |
Type: Gene; sRNA; |
Taxonomy: Eukaryota; Bacteria; | Ontology: Not found |
|
Description: DsrA RNA regulates both transcription, by overcoming transcriptional silencing by the nucleoid-associated H-NS protein, and translation, by promoting efficient translation of the stress sigma factor, RpoS. These two activities of DsrA can be separated by mutation: the first of three stem-loops of the 85 nucleotide RNA is necessary for RpoS translation but not for anti-H-NS action, while the second stem-loop is essential for antisilencing and less critical for RpoS translation. The third stem-loop, which behaves as a transcription terminator, can be substituted by the trp transcription terminator without loss of either DsrA function. The sequence of the first stem-loop of DsrA is complementary with the upstream leader portion of RpoS messenger RNA, suggesting that pairing of DsrA with the RpoS message might be important for translational regulation. |
Score: 102.8 |
E-value: 3.4e-20 |
From sequence: 2025313 |
To sequence: 2025227 |
Alignments: NC :::<<<<<<<_____>>>>>>>,,,<<<<<.<<<<<<<<_____>>>>>>>>->>->>>-<<<<<<<-<<____.>>->>> CS RF00014 1 aaCaCauCaGAUUUCCuGguGuAACgaauu.uuuaaGugCUUCUugCuuaagCaaGuucaauCCcGacccCuuc.ggGuCg 79 AACACAUCAGAUUUCCUGGUGUAAC:AAUU UUUAAGUGCUUCUUGCUUAAGCAAGUU: AUCCCGACCCC+UC GGGUCG gi_545778205_gb_U000 2025313 AACACAUCAGAUUUCCUGGUGUAACGAAUUuUUUAAGUGCUUCUUGCUUAAGCAAGUUUCAUCCCGACCCCCUCaGGGUCG 2025233 *****************************99************************************65555544****** PP
NC >>>>:: CS RF00014 80 GGauUU 85 GGAUUU gi_545778205_gb_U000 2025232 GGAUUU 2025227 ****** PP
|
RNAfold |
>gi_545778205_gb_U000_58 AAUCCCGACCCUGAGGGGGUCGGGAUGAAACUUGCUUAAGCAAGAAGCAC UUAAAAAAUUCGUUACACCAGGAAAUCUGAUGUGUU .(((((((((((...)))))))))))....(((((....)))))...................((((.(((.....))).)))).. (-29.70) |
|
Length sequence: 86 |
Length match: 85 |