gi_545778205_gb_U000_59 | ||
cmsearch-Rfam |
||
Family :FMN |
Id:RF00050 |
Type:Cis-reg; riboswitch; |
Taxonomy:Eukaryota; Bacteria; Archaea; | Ontology:GO:0010181 FMN binding |
|
Description:The RFN element is a highly conserved domain that is found frequently in the 5'-untranslated regionsof prokaryotic mRNAs that encode for flavin mononucleotide (FMN) biosynthesis and transport proteins. This element is a metabolite-dependent riboswitch that directly binds FMN in the absence of proteins. In Bacillus subtilis, the riboswitch most likely controls gene expression by causing premature transcription termination within the 5' untranslated region of the ribDEAHT operon and precluding access to the ribosome-binding site of ypaA mRNA [3]. | ||
Score:127.0 |
E-value:6.7e-31 |
|
From sequence:3184718 |
To sequence:3184570 |
|
Alignments: NC | ||
RNAfold |
||
>gi_545778205_gb_U000_59 GUUACUCUCUCCCAUCCGGACUCUAACCGUCGGCCCCGGAAUUACACCGG AUCUGCUGUCCUUUGAGUUCGCACCCAAAGCGCUCGCGGGCUUUCAACUG AGUUGAUUUACCGCCGGUGGGGAAUUUCGCCCCGCCCUGAGAAUAAGC .(((.((((.......(((((((.....(.((((.((((.......))))....)))).)....)))))))..............((((....(((((...)))))....)))).(((((((.......)))))))..)))).))).. (-45.00) |
||
Length sequence: 148 |
Length match:147 |