gi_545778205_gb_U000_61 | ||
cmsearch-Rfam |
||
Family :GadY |
Id:RF00122 |
Type:Gene; sRNA; |
Taxonomy:Bacteria; | Ontology:GO:0003729 mRNA binding |
|
Description:This family represents a GadY RNA (previous named IS183 in [1]). GadY can form base pairswith the 3' UTR of its target mRNA gadX, this pairing is thought to confer increased stability to the transcript, allowing accumulation of gadX (a transcriptional regulator of the acid response) and therefore increased expression of downstream acid resistance genes [2]. | ||
Score:150.0 |
E-value:1.4e-33 |
|
From sequence:3664861 |
To sequence:3664974 |
|
Alignments: NC | ||
RNAfold |
||
>gi_545778205_gb_U000_61 UUACUGAGAGCACAAAGUUUCCCGUGCCAACAGGGAGUGUUAUAACGGUU UAUUAGUCUGGAGACGGCAGACUAUCCUCUUCCCGGUCCCCUAUGCCGGG UUUUUUUUAUGUC ..((((..(((((......((((((....)).)))))))))....))))....(((((((.......))))))).......((((((.......))))))............. (-29.50) |
![]() |
|
Length sequence: 113 |
Length match:112 |