Ec_CsrB, | ||
cmscan-Rfam |
||
Family :CsrB |
Id:RF00018 |
Type:Gene; sRNA; |
Taxonomy:Eukaryota; Bacteria; | Ontology:GO:0005515 protein binding |
|
Description:The CsrB RNA binds to approximately 18 copies of the CsrA protein Pfam:PF02599. Although CsrA proteinsare found in a wide variety of bacteria, CsrB RNAs are only known in enterobacter. The CsrB RNAs contain a conserved motif CAGGXXG that is found in up to 18 copies and has been suggested to bind CsrA. The Csr regulatory system has a strong negative regulatory effect on glycogen biosynthesis, glyconeogenesis and glycogen catabolism and a positive regulatory effect on glycolysis [1]. In other bacteria such as Erwinia caratovara the RsmA protein has been shown to regulate the production of virulence determinants, such extracellular enzymes [2]. RsmA binds to RsmB regulatory RNA which is also a member of this family [2]. | ||
Score:376.7 |
E-value:2.6e-111 |
|
From sequence:1 |
To sequence:360 |
|
Alignments: NC | ||
RNAfold |
||
>Ec_CsrB, agucagacaacgaagugaacaucaggaugaugacacuucugcaggacaca ccaggaugguguuucagggaaaggcuucuggaugaagcgaagaggaugac gcaggacgcguuaaaggacaccuccaggauggagaaugagaaccggucag gaugauucggugggucaggaaggccagggacacuucaggaugaaguauca caucgggguggugugagcaggaagcaauaguucaggaugaacgauuggcc gcaaggccagaggaaaaguugucaaggaugagcagggagcaacaaaagua gcuggaaugcugcgaaacgaaccgggagcgcugugaauacagugcucccu uuuuuuauu .(((.((((((((((((..(((((...))))).))))))..(..((.((((((...)))))).))..).....(((((.....)))))........((((((.....))))))....(((((.((..((((..........((((((((...))).))))).((((.....))))...((.((((((...)))))).)).))))..)).)))))..((.....))....(((((...)))))..((((((....)))))).......))))))...))).((((...(((.((....)).)))....))))............(((((((((((....))))))))))).......... (-116.10) |
||
Length sequence: 359 |
Length match:358 |