Ec_RprA, | ||
cmscan-Rfam |
||
Family :RprA |
Id:RF00034 |
Type:Gene; sRNA; |
Taxonomy:Eukaryota; Bacteria; | Ontology:GO:0003729 mRNA binding |
|
Description:Translational regulation of the stationary phase sigma factor RpoS is mediated by the formation of adouble-stranded RNA stem-loop structure in the upstream region of the rpoS messenger RNA, occluding the translation initiation site. Clones carrying rprA (RpoS regulator RNA A) increased the translation of RpoS. The rprA gene encodes a 106 nucleotide regulatory RNA. As with DsrA Rfam:RF00014, RprA is predicted to form three stem-loops. Thus, at least two small RNAs, DsrA and RprA, participate in the positive regulation of RpoS translation. RprA also appears to bind to the RpoS leader [2]. RprA is non-essential [1]. The Y. pestis homologue was detected by similarity to the E. coli gene (pers obs. Bateman A). | ||
Score:110.6 |
E-value:3.3e-18 |
|
From sequence:1 |
To sequence:106 |
|
Alignments: NC | ||
RNAfold |
||
>Ec_RprA, cgguuauaaaucaacauauugauuuauaagcauggaaauccccugaguga aacaacgaauugcuguguguagucuuugcccaucucccacgaugggcuuu uuuuu .(.(((((((((((....))))))))))).)..((....)).................(((((.....)))))....(((((((......)))))))........ (-24.80) |
||
Length sequence: 105 |
Length match:105 |