rnpB | ||
cmscan-Rfam |
||
Family :RNaseP_bact_a |
Id:RF00010 |
Type:Gene; ribozyme; |
Taxonomy:Eukaryota; Bacteria; | Ontology:GO:0008033 tRNA processingRF00010 |
|
Description:Ribonuclease P (RNase P) is a ubiquitous endoribonuclease, found in archaea, bacteria and eukarya as wellas chloroplasts and mitochondria. Its best characterised activity is the generation of mature 5'-ends of tRNAs by cleaving the 5'-leader elements of precursor-tRNAs. Cellular RNase Ps are ribonucleoproteins. RNA from bacterial RNase Ps retains its catalytic activity in the absence of the protein subunit, i.e. it is a ribozyme. Isolated eukaryotic and archaeal RNase P RNA has not been shown to retain its catalytic function, but is still essential for the catalytic activity of the holoenzyme. Although the archaeal and eukaryotic holoenzyme s have a much greater protein content than the bacterial ones, the RNA cores from all the three lineages are homologous -- helices corresponding to P1, P2, P3, P4, and P10/11 are common to all cellular RNase P RNAs. Yet, there is considerable sequence variation, particularly among the eukaryotic RNAs. | ||
Score:312.6 |
E-value:3.5e-102 |
|
From sequence:1 |
To sequence:377 |
|
Alignments: v v NC | ||
RNAfold |
||
>rnpB AAGCUGACCAGACAGUCGCCGCUUCGUCGUCGUCCUCUUCGGGGGAGACG GGCGGAGGGGAGGAAAGUCCGGGCUCCAUAGGGCAGGGUGCCAGGUAACG CCUGGGGGGGAAACCCACGACCAGUGCAACAGAGAGCAAACCGCCGAUGG CCCGCGCAAGCGGGAUCAGGUAAGGGUGAAAGGGUGCGGUAAGAGCGCAC CGCGCGGCUGGUAACAGUCCGUGGCACGGUAAACUCCACCCGGAGCAAGG CCAAAUAGGGGUUCAUAAGGUACGGCCCGUACUGAACCCGGGUAGGCUGC UUGAGCCAGUGAGCGAUUGCUGGCCUAGAUGAAUGACUGUCCACGACAGA ACCCGGCUUAUCGGUCAGUUUCACCU (((((((((..((..((.((.((((((((((.(((((....)))))))).))))))).))..))..))((..(((((...(((..((((.((((((...)))))).(((....)))...(((.((((..............((((..((((((((....))))).)))......))))....((((((.......)))))).((((((((....))).))))))))))))..))))..))))))))..))........(((((((....(((((...)))))))))))).(((((((((((.(.((((((((....))))))))).))........(((((...)))))....))))))))))))))))))..... (-160.40) |
![]() |
|
Length sequence: 376 |
Length match:375 |