QUAD1d_tp8, | ||
cmscan-Rfam |
||
Family :SIB_RNA |
Id:RF00113 |
Type:Gene; antitoxin; |
Taxonomy:Eukaryota; Bacteria; | Ontology:GO:0003729 mRNA binding |
|
Description:This family contains multiple ncRNA from E. coli that were identified in a large scale screenof E. coli, were they were called candidates 43,55 and 61 [1]. These RNAs have also been identified by other groups and called QUAD RNAs. | ||
Score:120.4 |
E-value:2.8e-27 |
|
From sequence:1 |
To sequence:118 |
|
Alignments: NC | ||
RNAfold |
||
>QUAD1d_tp8, gaacaaggguaagggaggauuucuccccccucugauuggcuguuaauaag cugcgaaacuuacgaguaacaacacaaucaguaugaugacgagcuucauc auaacccuuuccuucuguaaggcccccuucuucgggaggggcuuuc ....((((((.((((.(((....))).))))((((((((.(((((.((((........))))....))))).).)))))))((((((((......)))))))))))))).........((((((((.(((....))))))))))). (-49.80) |
![]() |
|
Length sequence: 146 |
Length match:117 |